shRNA Lentivirus (self-inactivating), pH1-(FAM129C-shRNA-Seq1)(CAT#: LV-SI0928WQ)

This product is a FAM129C-shRNA encoding Lentivirus, which is based on HIV-1 serotype. Based on location and expression of FAM129C gene, this would suggest it has a role in immune system function. The expression of FAM129C-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert FAM129C-shRNA-Seq1
Related Target/Protein FAM129C
Region CDS
TargetSeq CTGAATCCTTGGGAGACCATA
NCBI RefSeq NM_173544
Alternative Names BCNP1; FAM129C
Titer >1*10^10 GC/mL
Related Diseases Colorectal cancer
Target Gene
Gene ID 199786
Uniprot ID Q86XR2

Related Products