shRNA Lentivirus (self-inactivating), pH1-(LOC392563-shRNA-Seq1)(CAT#: LV-SI2414WQ)
This product is a LOC392563-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by LOC392563 gene is a component of the mature neuronal cytoskeleton, and it interacts with the zygosome, which is mediated by neurofilament-related proteins. The expression of LOC392563-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | LOC392563-shRNA-Seq1 |
Related Target/Protein | LOC392563 |
Region | CDS |
TargetSeq | CCGCGGTATTTCGTGGAATAA |
NCBI RefSeq | XM_373382 |
Titer | >1*10^10 GC/mL |
Related Diseases | Neurodegenerative diseases |