shRNA Lentivirus (self-inactivating), pH1-(LRRC47-shRNA-Seq2)(CAT#: LV-SI0947WQ)

This product is a LRRC47-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The LRRC47 gene encodes a protein that significantly changed phosphorylation state in response to short-term vasopressin treatment. The expression of LRRC47-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert LRRC47-shRNA-Seq2
Related Target/Protein LRRC47
Region CDS
TargetSeq CCCACCAATAACCAACAGTGA
NCBI RefSeq NM_020710
Titer >1*10^10 GC/mL
Related Diseases Short-term vasopressin
Target Gene
Gene ID 57470
Uniprot ID Q8N1G4

Related Products