shRNA Lentivirus (self-inactivating), pH1-(Mrpl43-shRNA-Seq1)(CAT#: LV-SI3072WQ)
This product is a Mrpl43-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Mrpl43 gene help in protein synthesis within the mitochondrion. The expression of Mrpl43-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Mrpl43-shRNA-Seq1 |
Related Target/Protein | Mrpl43 |
Region | 3UTR |
TargetSeq | CAGATGAATCTCTGCGTTTAA |
NCBI RefSeq | NM_053164 |
Alternative Names | L43mt; MRP-L43; bMRP36a |
Titer | >1*10^10 GC/mL |