shRNA Lentivirus (self-inactivating), pH1-(NCRNA00085-shRNA-Seq1)(CAT#: LV-SI0610WQ)

Datasheet

This product is a NCRNA00085-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The NCRNA00085 gene encode the sperm protein potentially involved sperm-egg fusion. The expression of NCRNA00085-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert NCRNA00085-shRNA-Seq1
Related Target/Protein NCRNA00085
Region CDS
TargetSeq CGCATCTGCCAGATGTTTGTT
NCBI RefSeq NM_207324
Alternative Names LET7EH; SPACA6P; LINC00085; SPACA6
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 147650
Uniprot ID W5XKT8

Related Products

shRNA Lentivirus (self-inactivating), pU6-(OR5B17-shRNA-Seq1) (CAT#:LV-SI2156WQ) shRNA Lentivirus (self-inactivating), p7SK-(LOC441799-shRNA-Seq1) (CAT#:LV-SI3272WQ) shRNA Lentivirus (self-inactivating), p7SK-(Olfr376-shRNA-Seq1) (CAT#:LV-SI3725WQ) Recombinant lentivirus, pU6-(Human CYR61), Overexpression (CAT#:Lenti-GTOH0209WQ) shRNA Lentivirus (self-inactivating), pU6-(RNPS1-shRNA-Seq3) (CAT#:LV-SI0051WQ) shRNA Lentivirus (self-inactivating), pU6-(Lactb2-shRNA-Seq7) (CAT#:LV-SI1939WQ) Recombinant lentivirus, pU6-(Mouse Pdgfra 3'UTR), Overexpression (CAT#:Lenti-GTOH0372WQ) shRNA Lentivirus (self-inactivating), pH1-(SPAM1-shRNA-Seq1) (CAT#:LV-SI2356WQ)