shRNA Lentivirus (self-inactivating), pH1-(Olfr199-shRNA-Seq1)(CAT#: LV-SI3201WQ)

This product is a Olfr199-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Olfr199 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr199-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Olfr199-shRNA-Seq1
Related Target/Protein Olfr199
Region CDS
TargetSeq GCTGAGTGCTTTGTTCAATTT
NCBI RefSeq NM_207550
Alternative Names MOR182-14; GA_x5J8B7W8B52-93129-93296
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 404310
Uniprot ID Q7TS39

Related Products