shRNA Lentivirus (self-inactivating), pH1-(Olfr750-shRNA-Seq5)(CAT#: LV-SI2909WQ)

This product is a Olfr750-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Olfr750 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr750-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Olfr750-shRNA-Seq5
Related Target/Protein Olfr750
Region CDS
TargetSeq CCTCTTCTATGGAAGTGCCAT
NCBI RefSeq NM_207558
Alternative Names MOR103-18; GA_x5J8B7W5WBF-6267395-6266441; GA_x6K02T2PMLR-6808276-6807281
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 404319
Uniprot ID E9Q0Z1

Related Products