shRNA Lentivirus (self-inactivating), pH1-(OR8D1-shRNA-Seq1)(CAT#: LV-SI2469WQ)

This product is a OR8D1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR8D1 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR8D1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert OR8D1-shRNA-Seq1
Related Target/Protein OR8D1
Region CDS
TargetSeq CAGTTTGTCTTAGATGGTTTA
NCBI RefSeq XM_208543
Alternative Names JCG9; OR8D3; OST004; PDJ9J14
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 283159
Uniprot ID Q8WZ84

Related Products