shRNA Lentivirus (self-inactivating), pU6-(MRPS26-shRNA-Seq2)(CAT#: LV-SI0401WQ)
This product is a MRPS26-shRNA encoding Lentivirus, which is based on HIV-1 serotype. Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. The expression of MRPS26-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | MRPS26-shRNA-Seq2 |
Related Target/Protein | MRPS26 |
Region | 3UTR |
TargetSeq | CTGTCACCACTTGGTCAGAAA |
NCBI RefSeq | NM_030811 |
Alternative Names | GI008; MRPS13; RPMS13; MRP-S13; MRP-S26; NY-BR-87; C20orf193; dJ534B8.3 |
Titer | >1*10^10 GC/mL |
Related Diseases | Infertility |