shRNA Lentivirus (self-inactivating), pH1-(PCMTD1-shRNA-Seq1)(CAT#: LV-SI0576WQ)

This product is a PCMTD1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. PCMTD1 is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include protein-L-isoaspartate (D-aspartate) O-methyltransferase activity. The expression of PCMTD1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert PCMTD1-shRNA-Seq1
Related Target/Protein PCMTD1
Region CDS
TargetSeq GCATTGAAACTTCAACCAGGA
NCBI RefSeq NM_052937
Titer >1*10^10 GC/mL
Related Diseases Glaucoma, Lung cancer
Target Gene
Gene ID 115294
Uniprot ID Q96MG8

Related Products