shRNA Lentivirus (self-inactivating), pH1-(Poc5-shRNA-Seq5)(CAT#: LV-SI2743WQ)
This product is a Poc5-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Poc5 gene is essential for the assembly of the distal half of centrioles, required for centriole elongation. The expression of Poc5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Poc5-shRNA-Seq5 |
| Related Target/Protein | Poc5 |
| Region | CDS |
| TargetSeq | GAAGACAATTACAGCCCGGAT |
| NCBI RefSeq | NM_026173 |
| Alternative Names | C5orf37 |
| Titer | >1*10^10 GC/mL |
