shRNA Lentivirus (self-inactivating), pH1-(TRABD-shRNA-Seq2)(CAT#: LV-SI0750WQ)
This product is a TRABD-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The TRABD encodes metalloprotease that acts as a negative regulator of the Wnt signaling pathway by mediating the cleavage of the 8 N-terminal residues of a subset of Wnt proteins. The expression of TRABD-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | TRABD-shRNA-Seq2 |
Related Target/Protein | TRABD |
Region | 3UTR |
TargetSeq | CCACCCAAATAAAGGATTATT |
NCBI RefSeq | NM_025204 |
Alternative Names | LP6054; PP2447 |
Titer | >1*10^10 GC/mL |
Related Diseases | Graves' Disease |