shRNA Lentivirus (self-inactivating), pH1-(Pomp-shRNA-Seq2)(CAT#: LV-SI2576WQ)
This product is a Pomp-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Pomp gene is a molecular chaperone that binds 20S preproteasome components and is essential for 20S proteasome formation. The expression of Pomp-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Pomp-shRNA-Seq2 |
| Related Target/Protein | Pomp |
| Region | CDS |
| TargetSeq | GCTCAAACCTCTCACTGGATA |
| NCBI RefSeq | NM_025624 |
| Alternative Names | UMP1; PRAAS2; HSPC014; C13orf12; PNAS-110 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | KLICK syndrome |
