shRNA Lentivirus (self-inactivating), pU6-(Pof1b-shRNA-Seq3)(CAT#: LV-SI1774WQ)
This product is a Pof1b-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Pof1b gene is expressed at trace levels in mouse prenatal ovary and is barely detectable or absent from adult ovary, in human and in the mouse respectively. The expression of Pof1b-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Pof1b-shRNA-Seq3 |
| Related Target/Protein | Pof1b |
| Region | CDS |
| TargetSeq | CAGCCTCAGCATTACCACTAT |
| NCBI RefSeq | NM_181579 |
| Alternative Names | POF; POF2B |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Premature ovarian failure |
