shRNA Lentivirus (self-inactivating), pH1-(Pus7-shRNA-Seq2)(CAT#: LV-SI2634WQ)
This product is a Pus7-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Pus7 gene encodes pseudouridylate synthase that catalyzes pseudouridylation of RNAs. The expression of Pus7-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Pus7-shRNA-Seq2 |
| Related Target/Protein | Pus7 |
| Region | CDS |
| TargetSeq | GACTTTGTCGTTCACGAAATC |
| NCBI RefSeq | NM_178403 |
| Alternative Names | IDDABS |
| Titer | >1*10^10 GC/mL |
