shRNA Lentivirus (self-inactivating), pU6-(TMEM205-shRNA-Seq3)(CAT#: LV-SI0342WQ)

This product is a TMEM205-shRNA encoding Lentivirus, which is based on HIV-1 serotype. Elevated expression of TMEM205, a hypothetical membrane protein, is associated with cisplatin resistance. The expression of TMEM205-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert TMEM205-shRNA-Seq3
Related Target/Protein TMEM205
Region CDS
TargetSeq CTTCATCAACCTCTGCATCTT
NCBI RefSeq NM_198536
Alternative Names UNQ501
Titer >1*10^10 GC/mL
Related Diseases Ovarian cancer
Target Gene
Gene ID 374882
Uniprot ID Q6UW68

Related Products