shRNA Lentivirus (self-inactivating), pH1-(RSBN1-shRNA-Seq1)(CAT#: LV-SI0574WQ)
This product is a RSBN1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The RSBN1 gene specifically demethylates dimethylated 'Lys-20' of histone H4 (H4K20me2), thereby modulating chromosome architecture. The expression of RSBN1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | RSBN1-shRNA-Seq1 |
Related Target/Protein | RSBN1 |
Region | CDS |
TargetSeq | CGATCTCAAGCACAAGGACAA |
NCBI RefSeq | NM_018364 |
Alternative Names | KDM9; ROSBIN |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast cancer |