shRNA Lentivirus (self-inactivating), pH1-(RTBDN-shRNA-Seq1)(CAT#: LV-SI0874WQ)

This product is a RTBDN-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by RTBDN gene is preferentially expressed in the retina and may play a role in binding retinoids and other carotenoids as it shares homology with riboflavin binding proteins. The expression of RTBDN-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert RTBDN-shRNA-Seq1
Related Target/Protein RTBDN
Region CDS
TargetSeq CCTTACCTATGGACAGACCTT
NCBI RefSeq NM_031429
Titer >1*10^10 GC/mL
Related Diseases Eye disease
Target Gene
Gene ID 83546
Uniprot ID Q9BSG5

Related Products