shRNA Lentivirus (self-inactivating), pH1-(Scg2-shRNA-Seq1)(CAT#: LV-SI3122WQ)

This product is a Scg2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Scg2 gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins and is involved in the packaging or sorting of peptide hormones and neuropeptides into secretory vesicles. The expression of Scg2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Scg2-shRNA-Seq1
Related Target/Protein Scg2
Region CDS
TargetSeq CCCTTGATTCTCAGTCTATTT
NCBI RefSeq NM_009129
Alternative Names SN; CHGC; EM66; SgII
Titer >1*10^10 GC/mL
Related Diseases Nervous system disease
Target Gene
Gene ID 7857
Uniprot ID P13521

Related Products