shRNA Lentivirus (self-inactivating), pH1-(SESN3-shRNA-Seq2)(CAT#: LV-SI2564WQ)
This product is a SESN3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SESN3 gene encodes a member of the sestrin family of stress-induced proteins and plays a role in lipid storage in obesity. The expression of SESN3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | SESN3-shRNA-Seq2 |
Related Target/Protein | SESN3 |
Region | CDS |
TargetSeq | GCTGAACTTCTTTATGCTCTT |
NCBI RefSeq | NM_144665 |
Alternative Names | SEST3 |
Titer | >1*10^10 GC/mL |
Related Diseases | Obesity |