shRNA Lentivirus (self-inactivating), pH1-(SESN3-shRNA-Seq2)(CAT#: LV-SI2564WQ)

This product is a SESN3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SESN3 gene encodes a member of the sestrin family of stress-induced proteins and plays a role in lipid storage in obesity. The expression of SESN3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert SESN3-shRNA-Seq2
Related Target/Protein SESN3
Region CDS
TargetSeq GCTGAACTTCTTTATGCTCTT
NCBI RefSeq NM_144665
Alternative Names SEST3
Titer >1*10^10 GC/mL
Related Diseases Obesity
Target Gene
Gene ID 143686
Uniprot ID P58005

Related Products