shRNA Lentivirus (self-inactivating), pH1-(SESTD1-shRNA-Seq2)(CAT#: LV-SI0785WQ)
This product is a SESTD1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SESTD1 gene may act as the primary docking protein directing membrane turnover and assembly of the transient receptor potential channels TRPC4 and TRPC5. The expression of SESTD1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | SESTD1-shRNA-Seq2 |
| Related Target/Protein | SESTD1 |
| Region | CDS |
| TargetSeq | GCTGAGTGTCACCTTAGACTT |
| NCBI RefSeq | NM_178123 |
| Alternative Names | SOLO |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Lithium-responsive bipolar disorder |
