shRNA Lentivirus (self-inactivating), pH1-(Gsdmd-shRNA-Seq1)(CAT#: LV-SI3166WQ)

This product is a Gsdmd-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Gsdmd gene is a member of the gasdermin family and play a role in regulation of epithelial proliferation. The expression of Gsdmd-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Gsdmd-shRNA-Seq1
Related Target/Protein Gsdmd
Region CDS
TargetSeq CTGGTGAACATCGGAAAGATT
NCBI RefSeq NM_026960
Alternative Names DF5L; DFNA5L; FKSG10; GSDMDC1
Titer >1*10^10 GC/mL
Related Diseases Cancer
Target Gene
Gene ID 79792
Uniprot ID P57764

Related Products