shRNA Lentivirus (self-inactivating), pH1-(SF3A3-shRNA-Seq3)(CAT#: LV-SI0557WQ)

This product is a SF3A3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SF3A3 gene encodes subunit 3 of the splicing factor 3a protein complex, which interacts with subunit 1 through its amino-terminus while the zinc finger domain of subunit 3 plays a role in its binding to the 15S U2 snRNP. The expression of SF3A3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert SF3A3-shRNA-Seq3
Related Target/Protein SF3A3
Region CDS
TargetSeq CGAGACACTGAAAGGAACAAA
NCBI RefSeq NM_006802
Alternative Names PRP9; PRPF9; SAP61; SF3a60
Titer >1*10^10 GC/mL
Related Diseases Lung cancer
Target Gene
Gene ID 10946
Uniprot ID Q12874

Related Products