shRNA Lentivirus (self-inactivating), pH1-(MAP6D1-shRNA-Seq1)(CAT#: LV-SI0698WQ)
This product is a MAP6D1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The MAP6D1 gene encodes a protein highly similar to the mouse MAP6 domain containing 1 protein, which is related to the STOP proteins. The expression of MAP6D1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | MAP6D1-shRNA-Seq1 |
| Related Target/Protein | MAP6D1 |
| Region | CDS |
| TargetSeq | GTGAGGAAGAAGTTCACTCCT |
| NCBI RefSeq | NM_024871 |
| Alternative Names | SL21; MAPO6D1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Renal cancer |
