shRNA Lentivirus (self-inactivating), pH1-(SPANXN4-shRNA-Seq1)(CAT#: LV-SI0851WQ)

This product is a SPANXN4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SPANXN4 gene represents one of several duplicated family members that are located on the X chromosome. The expression of SPANXN4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert SPANXN4-shRNA-Seq1
Related Target/Protein SPANXN4
Region CDS
TargetSeq GAACAGAGTTTGAAAGAGACA
NCBI RefSeq NM_001009613
Alternative Names CT11.9
Titer >1*10^10 GC/mL
Target Gene
Gene ID 441525
Uniprot ID Q5MJ08

Related Products