shRNA Lentivirus (self-inactivating), pH1-(Tac4-shRNA-Seq1)(CAT#: LV-SI3085WQ)
This product is a Tac4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The products of Tac4 gene preferentially activate tachykinin receptor 1, and are thought to regulate peripheral endocrine and paracrine functions including blood pressure, the immune system, and endocrine gland secretion. The expression of Tac4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Tac4-shRNA-Seq1 |
Related Target/Protein | Tac4 |
Region | CDS |
TargetSeq | CCCAGCATTGAACTTAAGCTT |
NCBI RefSeq | NM_053093 |
Alternative Names | EK; HK1; HK-1; PPT-C |
Titer | >1*10^10 GC/mL |
Related Diseases | Nervous system disease |