shRNA Lentivirus (self-inactivating), pH1-(TMEM156-shRNA-Seq2)(CAT#: LV-SI0661WQ)
This product is a TMEM156-shRNA encoding Lentivirus, which is based on HIV-1 serotype. TMEM156 is expressed in several tissues including ascites, bone marrow, salivary glands, and vascular to name a few. It should be noted this gene is not ubiquitously expressed, but is still evident in many tissues. This gene is predominately expressed in adults but there is a bit of expression in fetuses. The expression of TMEM156-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | TMEM156-shRNA-Seq2 |
Related Target/Protein | TMEM156 |
Region | CDS |
TargetSeq | GTGGCAGAGTCATAGAGACAA |
NCBI RefSeq | NM_024943 |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast cancer, liver cancer and prostate cancer |