shRNA Lentivirus (self-inactivating), pH1-(TMEM156-shRNA-Seq2)(CAT#: LV-SI0661WQ)

This product is a TMEM156-shRNA encoding Lentivirus, which is based on HIV-1 serotype. TMEM156 is expressed in several tissues including ascites, bone marrow, salivary glands, and vascular to name a few. It should be noted this gene is not ubiquitously expressed, but is still evident in many tissues. This gene is predominately expressed in adults but there is a bit of expression in fetuses. The expression of TMEM156-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert TMEM156-shRNA-Seq2
Related Target/Protein TMEM156
Region CDS
TargetSeq GTGGCAGAGTCATAGAGACAA
NCBI RefSeq NM_024943
Titer >1*10^10 GC/mL
Related Diseases Breast cancer, liver cancer and prostate cancer
Target Gene
Gene ID 80008
Uniprot ID Q8N614

Related Products