shRNA Lentivirus (self-inactivating), p7SK-(OR4F5-shRNA-Seq1)(CAT#: LV-SI3880WQ)

This product is a OR4F5-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR4F5 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR4F5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert OR4F5-shRNA-Seq1
Related Target/Protein OR4F5
Region CDS
TargetSeq CAGATACCTACAGGCTAGATA
NCBI RefSeq NM_001005484
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 79501
Uniprot ID Q8NH21

Related Products