shRNA Lentivirus (self-inactivating), pH1-(ZDHHC3-shRNA-Seq2)(CAT#: LV-SI0969WQ)

This product is a ZDHHC3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. ZDHHC3 Tyrosine Phosphorylation Regulates Neural Cell Adhesion Molecule Palmitoylation. The expression of ZDHHC3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert ZDHHC3-shRNA-Seq2
Related Target/Protein ZDHHC3
Region CDS
TargetSeq GAAGAAGATTGGACAACCTAT
NCBI RefSeq NM_016598
Alternative Names GODZ; DHHC3; DHHC-3; ZNF373
Titer >1*10^10 GC/mL
Related Diseases Breast Cancer
Target Gene
Gene ID 51304
Uniprot ID Q9NYG2

Related Products