shRNA Lentivirus (self-inactivating), pU6-(2010110P09Rik-shRNA-Seq4)(CAT#: LV-SI2080WQ)

This product is a 2010110P09Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 2010110P09Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert 2010110P09Rik-shRNA-Seq4
Related Target/Protein 2010110P09Rik
Region CDS
TargetSeq GCGCTTTGCATTTCAGCTCTA
NCBI RefSeq XM_355937
Alternative Names Cbhp2; Chp2
Titer >1*10^10 GC/mL
Target Gene
Gene ID 70261
Uniprot ID Q9D869

Related Products