shRNA Lentivirus (self-inactivating), pU6-(2310044H10Rik-shRNA-Seq2)(CAT#: LV-SI1948WQ)

This product is a 2310044H10Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 2310044H10Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert 2310044H10Rik-shRNA-Seq2
Related Target/Protein 2310044H10Rik
Region CDS
TargetSeq GAAGTCTTTCTTTGCCAAATA
NCBI RefSeq NM_197991
Alternative Names Inm02; Mirta22; Emc10; 5430410O10Rik
Titer >1*10^10 GC/mL
Target Gene
Gene ID 69683
Uniprot ID A0A0X1KG67

Related Products