shRNA Lentivirus (self-inactivating), pU6-(2310044H10Rik-shRNA-Seq3)(CAT#: LV-SI1949WQ)
This product is a 2310044H10Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 2310044H10Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | 2310044H10Rik-shRNA-Seq3 |
| Related Target/Protein | 2310044H10Rik |
| Region | CDS |
| TargetSeq | CAGAAGTCTTTCTTTGCCAAA |
| NCBI RefSeq | NM_197991 |
| Alternative Names | Inm02; Mirta22; Emc10; 5430410O10Rik |
| Titer | >1*10^10 GC/mL |
| Target Gene | |
|---|---|
| Gene ID | 69683 |
| Uniprot ID | A0A0X1KG67 |
