shRNA Lentivirus (self-inactivating), pU6-(4930412M03Rik-shRNA-Seq1)(CAT#: LV-SI1718WQ)

This product is a 4930412M03Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 4930412M03Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert 4930412M03Rik-shRNA-Seq1
Related Target/Protein 4930412M03Rik
Region CDS
TargetSeq CATCATGCAATTGTGATTATT
NCBI RefSeq NM_177098
Titer >1*10^10 GC/mL
Target Gene
Gene ID 100504140
Uniprot ID Q8CDU0

Related Products