shRNA Lentivirus (self-inactivating), pU6-(4933409G03Rik-shRNA-Seq4)(CAT#: LV-SI1796WQ)

This product is a 4933409G03Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 4933409G03Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert 4933409G03Rik-shRNA-Seq4
Related Target/Protein 4933409G03Rik
Region CDS
TargetSeq CCAAGAGAATTATTGTCAGAA
NCBI RefSeq NM_177651
Titer >1*10^10 GC/mL
Target Gene
Gene ID 227998
Uniprot ID Q8C5U0

Related Products