shRNA Lentivirus (self-inactivating), pU6-(6430548M08Rik-shRNA-Seq1)(CAT#: LV-SI2319WQ)

This product is a 6430548M08Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 6430548M08Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert 6430548M08Rik-shRNA-Seq1
Related Target/Protein 6430548M08Rik
Region CDS
TargetSeq CAATGAGTCCTTCTCCTCCAA
NCBI RefSeq NM_172286
Alternative Names AW049007; Kiaa0513; mKIAA0513
Titer >1*10^10 GC/mL
Target Gene
Gene ID 234797
Uniprot ID D3YUS2

Related Products