shRNA Lentivirus (self-inactivating), pU6-(CTTNBP2NL-shRNA-Seq1)(CAT#: LV-SI0293WQ)

This product is a CTTNBP2NL-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of CTTNBP2NL-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert CTTNBP2NL-shRNA-Seq1
Related Target/Protein CTTNBP2NL
Region CDS
TargetSeq CTTTGGCACAGACTATCGAAA
NCBI RefSeq NM_018704
Alternative Names KIAA1433
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55917
Uniprot ID Q9P2B4

Related Products