shRNA Lentivirus (self-inactivating), pU6-(Adipor1-shRNA-Seq3)(CAT#: LV-SI1835WQ)

This product is a Adipor1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Adipor1 gene encodes a protein which acts as a receptor for adiponectin, a hormone secreted by adipocytes which regulates fatty acid catabolism and glucose levels. The expression of Adipor1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Adipor1-shRNA-Seq3
Related Target/Protein Adipor1
Region 3UTR
TargetSeq CTGGGATTCTTCAGAAATTAT
NCBI RefSeq NM_028320
Alternative Names CGI45; PAQR1; ACDCR1; CGI-45; TESBP1A
Titer >1*10^10 GC/mL
Related Diseases Obesity; Diabetes
Target Gene
Gene ID 51094
Uniprot ID Q96A54

Related Products