shRNA Lentivirus (self-inactivating), pU6-(Adipor1-shRNA-Seq3)(CAT#: LV-SI1835WQ)
This product is a Adipor1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Adipor1 gene encodes a protein which acts as a receptor for adiponectin, a hormone secreted by adipocytes which regulates fatty acid catabolism and glucose levels. The expression of Adipor1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Adipor1-shRNA-Seq3 |
| Related Target/Protein | Adipor1 |
| Region | 3UTR |
| TargetSeq | CTGGGATTCTTCAGAAATTAT |
| NCBI RefSeq | NM_028320 |
| Alternative Names | CGI45; PAQR1; ACDCR1; CGI-45; TESBP1A |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Obesity; Diabetes |
