shRNA Lentivirus (self-inactivating), pU6-(Atxn7l1-shRNA-Seq5)(CAT#: LV-SI1860WQ)

Datasheet

This product is a Atxn7l1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Atxn7l1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Atxn7l1-shRNA-Seq5
Related Target/Protein Atxn7l1
Region CDS
TargetSeq CGAGAAGTTAGACTGTCAGTT
NCBI RefSeq NM_001033436
Alternative Names ATXN7L4
Titer >1*10^10 GC/mL
Target Gene
Gene ID 222255
Uniprot ID Q9ULK2

Related Products

Recombinant lentivirus, pU6-(Human DRD2), Overexpression (CAT#:Lenti-GTOH0231WQ) Recombinant lentivirus, pU6-(Human HTR2A), Overexpression (CAT#:Lenti-GTOH0230WQ) shRNA Lentivirus (self-inactivating), p7SK-(CDCA3-shRNA-Seq2) (CAT#:LV-SI1125WQ) shRNA Lentivirus (self-inactivating), p7SK-(N4bp2-shRNA-Seq3) (CAT#:LV-SI3625WQ) shRNA Lentivirus (self-inactivating), pU6-(2010110P09Rik-shRNA-Seq4) (CAT#:LV-SI2080WQ) shRNA Lentivirus (self-inactivating), pU6-(C1orf216-shRNA-Seq2) (CAT#:LV-SI0191WQ) shRNA Lentivirus (self-inactivating), pU6-(Prlhr-shRNA-Seq1) (CAT#:LV-SI2325WQ) Recombinant lentivirus, pU6-(Human UBE21), Overexpression (CAT#:Lenti-GTOH0035WQ)