shRNA Lentivirus (self-inactivating), pU6-(FAM24B-shRNA-Seq1)(CAT#: LV-SI1950WQ)

This product is a FAM24B-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of FAM24B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert FAM24B-shRNA-Seq1
Related Target/Protein FAM24B
Region CDS
TargetSeq GCTGTGAAGGATATAGAATGT
NCBI RefSeq NM_152644
Titer >1*10^10 GC/mL
Target Gene
Gene ID 196792
Uniprot ID Q8N5W8

Related Products