shRNA Lentivirus (self-inactivating), pU6-(Btla-shRNA-Seq3)(CAT#: LV-SI1730WQ)

Datasheet

This product is a Btla-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Btla gene is a member of the immunoglobulin superfamily and relays inhibitory signals to suppress the immune response. The expression of Btla-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Btla-shRNA-Seq3
Related Target/Protein Btla
Region CDS
TargetSeq CCCACAGAATATGCATCCATT
NCBI RefSeq NM_177584
Alternative Names BTLA1; CD272
Titer >1*10^10 GC/mL
Related Diseases Rheumatoid arthritis.
Target Gene
Gene ID 151888
Uniprot ID Q7Z6A9

Related Products

Recombinant lentivirus, pU6-(Human SREBF1 3'UTR), Overexpression (CAT#:Lenti-GTOH0632WQ) shRNA Lentivirus (self-inactivating), p7SK-(DKFZp434P055-shRNA-Seq1) (CAT#:LV-SI1329WQ) shRNA Lentivirus (self-inactivating), pH1-(PIGW-shRNA-Seq1) (CAT#:LV-SI0640WQ) shRNA Lentivirus (self-inactivating), pU6-(AI837181-shRNA-Seq3) (CAT#:LV-SI1832WQ) shRNA Lentivirus (self-inactivating), p7SK-(SESN3-shRNA-Seq2) (CAT#:LV-SI3414WQ) shRNA Lentivirus (self-inactivating), pU6-(MAP6D1-shRNA-Seq3) (CAT#:LV-SI0199WQ) Recombinant lentivirus, pU6-(Human IL2), Overexpression (CAT#:Lenti-GTOH0198WQ) Recombinant lentivirus, pU6-(Human IFNA1), Overexpression (CAT#:Lenti-GTOH0199WQ)