shRNA Lentivirus (self-inactivating), pU6-(C17orf77-shRNA-Seq2)(CAT#: LV-SI0203WQ)
This product is a C17orf77-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of C17orf77-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | C17orf77-shRNA-Seq2 |
Related Target/Protein | C17orf77 |
Region | CDS |
TargetSeq | GTCTCTTGCTCACTTCCTGTT |
NCBI RefSeq | NM_152460 |
Titer | >1*10^10 GC/mL |