shRNA Lentivirus (self-inactivating), pU6-(Lsm14a-shRNA-Seq5)(CAT#: LV-SI1782WQ)

This product is a Lsm14a-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Lsm14a gene encodes Sm-like proteins that are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing. The expression of Lsm14a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Lsm14a-shRNA-Seq5
Related Target/Protein Lsm14a
Region CDS
TargetSeq CTCAGTTAGACCCTTTGAGAA
NCBI RefSeq NM_025948
Alternative Names RAP55; FAM61A; RAP55A; C19orf13
Titer >1*10^10 GC/mL
Target Gene
Gene ID 26065
Uniprot ID Q8ND56

Related Products