shRNA Lentivirus (self-inactivating), pU6-(C22orf33-shRNA-Seq1)(CAT#: LV-SI0209WQ)

This product is a C22orf33-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of C22orf33-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C22orf33-shRNA-Seq1
Related Target/Protein C22orf33
Region CDS
TargetSeq GAAATCAGTGAGGGACTTAGA
NCBI RefSeq NM_178552
Alternative Names EAN57; TEX33; cE81G9.2
Titer >1*10^10 GC/mL
Target Gene
Gene ID 339669
Uniprot ID O43247

Related Products