shRNA Lentivirus (self-inactivating), pU6-(C6orf165-shRNA-Seq1)(CAT#: LV-SI0461WQ)
This product is a C6orf165-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C6orf165 gene may regulate cilium motility through its role in the assembly of the axonemal radial spokes. The expression of C6orf165-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | C6orf165-shRNA-Seq1 |
| Related Target/Protein | C6orf165 |
| Region | CDS |
| TargetSeq | GCAGCATATTGATTACCAGCT |
| NCBI RefSeq | NM_178823 |
| Alternative Names | CFAP206; dJ382I10.1 |
| Titer | >1*10^10 GC/mL |
