shRNA Lentivirus (self-inactivating), pU6-(Slfnl1-shRNA-Seq1)(CAT#: LV-SI2337WQ)

This product is a Slfnl1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Slfnl1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Slfnl1-shRNA-Seq1
Related Target/Protein Slfnl1
Region CDS
TargetSeq GCACACATACTCTTTACGTGA
NCBI RefSeq NM_177570
Titer >1*10^10 GC/mL
Target Gene
Gene ID 200172
Uniprot ID Q499Z3

Related Products