shRNA Lentivirus (self-inactivating), pU6-(CABIN1-shRNA-Seq3)(CAT#: LV-SI0229WQ)
This product is a CABIN1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by CABIN1 gene binds specifically to the activated form of calcineurin and inhibits calcineurin-mediated signal transduction. The expression of CABIN1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | CABIN1-shRNA-Seq3 |
Related Target/Protein | CABIN1 |
Region | CDS |
TargetSeq | CTGCGATTCTATGTGCGAGTA |
NCBI RefSeq | NM_012295 |
Alternative Names | CAIN; PPP3IN; KB-318B8.7 |
Titer | >1*10^10 GC/mL |
Related Diseases | Glomerular podocyte injury |