shRNA Lentivirus (self-inactivating), pU6-(CASC4-shRNA-Seq1)(CAT#: LV-SI0116WQ)
This product is a CASC4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The increased expression level of CASC4 gene is associated with HER-2/neu proto-oncogene overexpression. Amplification and resulting overexpression of this proto-oncogene are found in approximately 30% of human breast and 20% of human ovarian cancers. The expression of CASC4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | CASC4-shRNA-Seq1 |
Related Target/Protein | CASC4 |
Region | CDS |
TargetSeq | GATGATGAAGAACGAGAGCTT |
NCBI RefSeq | NM_138423 |
Alternative Names | H63 |
Titer | >1*10^10 GC/mL |
Related Diseases | Ovarian cancers, Breast cancer |