shRNA Lentivirus (self-inactivating), pU6-(OR8H3-shRNA-Seq5)(CAT#: LV-SI2150WQ)

This product is a OR8H3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR8H3 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR8H3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert OR8H3-shRNA-Seq5
Related Target/Protein OR8H3
Region CDS
TargetSeq CCTCTACACTACACAGTTATT
NCBI RefSeq XM_372391
Alternative Names OR11-172
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 390152
Uniprot ID Q8N146

Related Products