shRNA Lentivirus (self-inactivating), pU6-(Cbwd1-shRNA-Seq5)(CAT#: LV-SI1955WQ)

This product is a Cbwd1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Cbwd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Cbwd1-shRNA-Seq5
Related Target/Protein Cbwd1
Region CDS
TargetSeq CTATGATATTCTCTCTGGAAT
NCBI RefSeq NM_146097
Alternative Names COBP
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55871
Uniprot ID Q9BRT8

Related Products