shRNA Lentivirus (self-inactivating), pU6-(CCDC116-shRNA-Seq2)(CAT#: LV-SI0107WQ)
This product is a CCDC116-shRNA encoding Lentivirus, which is based on HIV-1 serotype. A cis-eQTL genetic variant of the cancer-testis gene CCDC116 is associated with risk of multiple cancers. The expression of CCDC116-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | CCDC116-shRNA-Seq2 |
| Related Target/Protein | CCDC116 |
| Region | CDS |
| TargetSeq | GTTCAAGGATGAAGACCAGGA |
| NCBI RefSeq | NM_152612 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | colorectal cancer, breast cancer, esophageal cancer, gastric cancer |
